GeneTex
United States (US)

Methylated cytosine DNA standard kit

GTX400004_DNA standard set Dot blot_18121410_676.jpg
GTX400004_DNA Standard Set_18121410_279.jpg

Cat No. GTX400004

Application Dot
PRODUCT

Content

Content Package Conc. Storage
Cytosine DNA Standard 2 μg 50 ng/μl -20 ºC
5-Methylcytosine DNA Standard 2 μg 50 ng/μl -20 ºC
5-Hydroxymethylcytosine DNA Standard 2 μg 50 ng/μl -20 ºC
5-Formylcytosine DNA Standard 2 μg 50 ng/μl -20 ºC
5-Carboxylcytosine DNA Standard 2 μg 50 ng/μl -20 ºC

Product Description

The Methylated cytosine DNA standard kit is a set of five DNA standards that are linear dsDNA, 426 bp, and have the same sequence (see sequence below & figure). The only difference is that each contains either normal cytosines, 5-methylcytosines, 5-hydroxymethylcytosines, 5-formylcytosines, or 5-carboxylcytosines. Since the sequence and extent of cytosine modification is known, this DNA standard set is ideal for use in calibration of various applications intended for quantitation of cytosine modifications.
Sequence Information:
5'CGGGGTACCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGA GCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATG GGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATA TCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATAT TTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACC ATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAA GACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAAGAATTC CCG 3'
Note: Sequence is same for all five standards. Depending on the DNA, all C’s are unmodified cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Sequence statistics:

Nucleotide Count Frequency (%)
Adenine (A) 138 32.4 %
Thymine (T) 103 24.2 %
Cytosine (C) 88 20.7 %
Guanine (G) 97 22.8 %
C+G 185 43.4 %
A+T 241 56.6 %
APPLICATION

Application Note

*Optimal dilutions/concentrations should be determined by the researcher.
Application Dilution
Dot Assay dependent
Not tested in other applications.
PROPERTIES

Form

Liquid

Buffer

10mM Tris-HCl; 0.1mM EDTA; pH 8.0. All standards are supplied in 40 μl volume.

Storage

Store at -20ºC. Avoid multiple freeze/thaw cycles. For long-term storage ≤ -70 ºC., and to prevent cross-contamination. Aliquoting is recommended.

Concentration

50 ng/μl (Please refer to the vial label for the specific concentration.)

Note

For laboratory use only. Not for any clinical, therapeutic, or diagnostic use in humans or animals. Not for animal or human consumption.
TARGET

Synonyms

5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxylcytosine
DATA IMAGES
GTX400004_DNA standard set Dot blot_18121410_676.jpg

GTX400004 Dot Image

GeneTex methylated cytosine DNA standard kit includes five recombinant double-strand DNA fragments: unmethylated cytosine DNA (C), 5-methylated cytosine DNA (5mC), 5-hydroxymethycytosine cytosine DNA (5hmC), 5-formylcytosine cytosine DNA (5fC), 5-carboxylcytosine cytosine DNA (5caC). Each methylated cytosine DNA was spotted onto a positively charged nylon membrane and subjected to Dot blot assay with corresponding antibodies.
The membrane was incubated with anti-5hmc monoclonal antibody (GTX629701) at a dilution of 1:500 or with anti-5mc monoclonal antibody (GTX629448) at a dilution of 1:500

GTX400004_DNA Standard Set_18121410_279.jpg

GTX400004 Dot Image

All five standards are 426 bp with all cytosines either unmodified (lane 1, C), 5-methylcytosine (lane 2, 5mC), 5-hydroxymethylcytosine (lane 3, 5hmC), 5-formylcytosin (lane4, 5fC), 5-carboxycytosine (lane5, 5-caC). DNA marker: 1 kb Plus DNA marker.

Package List Price ($)
$ 299